Review



control scrambled shrna ccgcaggtatgcacgcgt  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc control scrambled shrna ccgcaggtatgcacgcgt
    (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 <t>shRNA</t> plasmids at E14.5 and analyzed at E16.5. Immunostaining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 μm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2.
    Control Scrambled Shrna Ccgcaggtatgcacgcgt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 361 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control scrambled shrna ccgcaggtatgcacgcgt/product/Addgene inc
    Average 96 stars, based on 361 article reviews
    control scrambled shrna ccgcaggtatgcacgcgt - by Bioz Stars, 2026-03
    96/100 stars

    Images

    1) Product Images from "CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development"

    Article Title: CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development

    Journal: Neuron

    doi: 10.1016/j.neuron.2017.02.039

    (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 shRNA plasmids at E14.5 and analyzed at E16.5. Immunostaining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 μm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2.
    Figure Legend Snippet: (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 shRNA plasmids at E14.5 and analyzed at E16.5. Immunostaining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 μm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2.

    Techniques Used: In Utero, Control, shRNA, Immunostaining, Marker, Knockdown

    (A–C) Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at E16.5 (A, control, n = 6 brains; CLASP2 shRNA, n = 6 brains), P0 (B, control, n = 3 brains; CLASP2 shRNA, n = 6 brains) and P14 (C, control, n = 4 brains; CLASP2 shRNA, n = 6 brains). Coronal sections of the cortex were visualized for transfected GFP-positive neurons (green) and cell nuclei (Hoeschst 33342, blue). White lines indicate the demarcations for different cortical regions (VZ = ventricular zone, SVZ = subventricular zone, IZ = intermediate zone, CP = cortical plate, loCL = lower cortical layer, upCL = upper cortical layer, WM = white matter). For additional data, see Figure S3.
    Figure Legend Snippet: (A–C) Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at E16.5 (A, control, n = 6 brains; CLASP2 shRNA, n = 6 brains), P0 (B, control, n = 3 brains; CLASP2 shRNA, n = 6 brains) and P14 (C, control, n = 4 brains; CLASP2 shRNA, n = 6 brains). Coronal sections of the cortex were visualized for transfected GFP-positive neurons (green) and cell nuclei (Hoeschst 33342, blue). White lines indicate the demarcations for different cortical regions (VZ = ventricular zone, SVZ = subventricular zone, IZ = intermediate zone, CP = cortical plate, loCL = lower cortical layer, upCL = upper cortical layer, WM = white matter). For additional data, see Figure S3.

    Techniques Used: In Utero, Control, shRNA, Transfection

    (A–B) Immunostaining for Pericentrin (red) shows centrosome localization and demonstrates a shorter distance between the nucleus and centrosome in CLASP2 knockdown neurons (control, n = 43 cells; CLASP2 shRNA, n = 53 cells). Nuclei were stained with DAPI (blue).
    Figure Legend Snippet: (A–B) Immunostaining for Pericentrin (red) shows centrosome localization and demonstrates a shorter distance between the nucleus and centrosome in CLASP2 knockdown neurons (control, n = 43 cells; CLASP2 shRNA, n = 53 cells). Nuclei were stained with DAPI (blue).

    Techniques Used: Immunostaining, Knockdown, Control, shRNA, Staining

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Double Knockout, Knock-Out, Recombinant, Flow Cytometry, Gene Expression, Stable Transfection, shRNA, Sequencing, Control, Software, Microscopy

    TABLE WITH EXAMPLES FOR AUTHOR REFERENCE
    Figure Legend Snippet: TABLE WITH EXAMPLES FOR AUTHOR REFERENCE

    Techniques Used: Cell Culture, Recombinant, Labeling, Sample Prep, Plasmid Preparation, shRNA, Sequencing, Software



    Similar Products

    plko.1-eef1a2 shrna (trc clone id- trcn0000219908) along with control scrambled shrna sequence  (Millipore)
    90
    Millipore plko.1-eef1a2 shrna (trc clone id- trcn0000219908) along with control scrambled shrna sequence
    Plko.1 Eef1a2 Shrna (Trc Clone Id Trcn0000219908) Along With Control Scrambled Shrna Sequence, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko.1-eef1a2 shrna (trc clone id- trcn0000219908) along with control scrambled shrna sequence/product/Millipore
    Average 90 stars, based on 1 article reviews
    plko.1-eef1a2 shrna (trc clone id- trcn0000219908) along with control scrambled shrna sequence - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    control scrambled shrna ccgcaggtatgcacgcgt  (Addgene inc)
    96
    Addgene inc control scrambled shrna ccgcaggtatgcacgcgt
    (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 <t>shRNA</t> plasmids at E14.5 and analyzed at E16.5. Immunostaining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 μm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2.
    Control Scrambled Shrna Ccgcaggtatgcacgcgt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control scrambled shrna ccgcaggtatgcacgcgt/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    control scrambled shrna ccgcaggtatgcacgcgt - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    plko 1 trc scrambled control shrna  (Addgene inc)
    93
    Addgene inc plko 1 trc scrambled control shrna
    (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 <t>shRNA</t> plasmids at E14.5 and analyzed at E16.5. Immunostaining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 μm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2.
    Plko 1 Trc Scrambled Control Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 trc scrambled control shrna/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    plko 1 trc scrambled control shrna - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 shRNA plasmids at E14.5 and analyzed at E16.5. Immunostaining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 μm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2.

    Journal: Neuron

    Article Title: CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development

    doi: 10.1016/j.neuron.2017.02.039

    Figure Lengend Snippet: (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 shRNA plasmids at E14.5 and analyzed at E16.5. Immunostaining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 μm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2.

    Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

    Techniques: In Utero, Control, shRNA, Immunostaining, Marker, Knockdown

    (A–C) Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at E16.5 (A, control, n = 6 brains; CLASP2 shRNA, n = 6 brains), P0 (B, control, n = 3 brains; CLASP2 shRNA, n = 6 brains) and P14 (C, control, n = 4 brains; CLASP2 shRNA, n = 6 brains). Coronal sections of the cortex were visualized for transfected GFP-positive neurons (green) and cell nuclei (Hoeschst 33342, blue). White lines indicate the demarcations for different cortical regions (VZ = ventricular zone, SVZ = subventricular zone, IZ = intermediate zone, CP = cortical plate, loCL = lower cortical layer, upCL = upper cortical layer, WM = white matter). For additional data, see Figure S3.

    Journal: Neuron

    Article Title: CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development

    doi: 10.1016/j.neuron.2017.02.039

    Figure Lengend Snippet: (A–C) Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at E16.5 (A, control, n = 6 brains; CLASP2 shRNA, n = 6 brains), P0 (B, control, n = 3 brains; CLASP2 shRNA, n = 6 brains) and P14 (C, control, n = 4 brains; CLASP2 shRNA, n = 6 brains). Coronal sections of the cortex were visualized for transfected GFP-positive neurons (green) and cell nuclei (Hoeschst 33342, blue). White lines indicate the demarcations for different cortical regions (VZ = ventricular zone, SVZ = subventricular zone, IZ = intermediate zone, CP = cortical plate, loCL = lower cortical layer, upCL = upper cortical layer, WM = white matter). For additional data, see Figure S3.

    Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

    Techniques: In Utero, Control, shRNA, Transfection

    (A–B) Immunostaining for Pericentrin (red) shows centrosome localization and demonstrates a shorter distance between the nucleus and centrosome in CLASP2 knockdown neurons (control, n = 43 cells; CLASP2 shRNA, n = 53 cells). Nuclei were stained with DAPI (blue).

    Journal: Neuron

    Article Title: CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development

    doi: 10.1016/j.neuron.2017.02.039

    Figure Lengend Snippet: (A–B) Immunostaining for Pericentrin (red) shows centrosome localization and demonstrates a shorter distance between the nucleus and centrosome in CLASP2 knockdown neurons (control, n = 43 cells; CLASP2 shRNA, n = 53 cells). Nuclei were stained with DAPI (blue).

    Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

    Techniques: Immunostaining, Knockdown, Control, shRNA, Staining

    KEY RESOURCES TABLE

    Journal: Neuron

    Article Title: CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development

    doi: 10.1016/j.neuron.2017.02.039

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

    Techniques: Double Knockout, Knock-Out, Recombinant, Flow Cytometry, Gene Expression, Stable Transfection, shRNA, Sequencing, Control, Software, Microscopy

    TABLE WITH EXAMPLES FOR AUTHOR REFERENCE

    Journal: Neuron

    Article Title: CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development

    doi: 10.1016/j.neuron.2017.02.039

    Figure Lengend Snippet: TABLE WITH EXAMPLES FOR AUTHOR REFERENCE

    Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

    Techniques: Cell Culture, Recombinant, Labeling, Sample Prep, Plasmid Preparation, shRNA, Sequencing, Software